htert lentivirus This plasmid was co-transfected into 293Ta cells (GeneCopoeia Cat. After hypoglycemia developed in the mice, cells were removed and propagated in tissue culture as insulin-containing cells that secreted insulin in response to glucose challenge. A ribonucleoprotein, telomerase is able to extend the DNA sequence of telomeres, thus abating the senescence process and enabling the cells to undergo infinite cell divisions. Antitumor effect mediated by double gene-modified CD8 + T cells using hTERT-specific TCR and cCD16ζ gene transfer. The hTERT gene was introduced into each culture using a lentivirus construct containing zeocin resistance. Lentivirus, expressing hTERT, was produced as described in (Böckeret al. The titer of the lentivirus was measured by qRT-PCR titration kit. The ensuing bi-cistronic construct contains the full-length hTERT coding sequence under the control of the human cytomegalovirus immediate early promoter (CMVie), followed by the encephalomyocarditis virus internal ribosome entry site (IRES) and the enhanced green fluorescence protein (EGFP). As mentioned above, lentiviruses stably integrate their DNA into mammalian genomes [7,15]. 91 and 12 μg of lentivector into 293T cells (ATCC) using Lipofectamine 2000 (Invitrogen). The recombinant lentivirus vector including the hTERT promoter modified by the artificial 8HSEs, the EGFP gene and a 3FLAG marker (pLVX-8HSEs-hTERTp-EGFP-3FLAG) was constructed using conventional recombinant techniques. Cells were analyzed for telomerase activity, proliferative capacity, hepatocyte markers, and tumorigenicity (c-myc) expression. Our aim was to assess the po-tential application of MR reporter imaging, mediated Recombinant lentivirus (GFP-hTERT IRES hygro) was produced by co-transfecting 4 μg of pMD. To confirm that hTERT was functional when expressed from the lentivirus construct, we infected simian virus 40-transformed HA-5 cells with hTERT or GFP. BR. (A) HeLa cells were transduced with lentiviruses expressing hTERT, K626A and GFP as a control. Our e-newsletter is a great way to stay up to date on the most recent news and products from Cell Biolabs. Gag protein–specific p24 antibody was given by Dr G. . Briefly,one10-cmculturedish containing 1. In contrast to other enzymes, Drosophila melanogaster deoxyribonucleoside kinase (Dm-dNK) has a broad substrate specificity and high catalytic rate when transferred in human cells. BIBR 1532 is a novel, specific telomerase inhibitor with IC50 = 93 nM. Methods In this study, we developed two novel radiation resistance cervical cancer cell lines, which could mimic clinical The shRNA sequence targeting human TERT cDNA was synthesized by GenePharma: hTERT KD: 5’-CCGAAGAAGCCACCUCUUUTT-3′, Lentiviral vectors pGLV3/H1/GFP were acquired from GenePharma. The lentivirus plasmids pBARL (β-catenin a ctivated r eporter l uciferase) and pfuBARL (mutated pBARL) and pSL9/rLuc (Renilla l uciferase) were obtained from the laboratory of Randall Moon, University of Washington . . Lentivirus-based RNAi was used to create a series of Plk1 hypomorphs. Office (Main Mailing/Accounts Receivable) 12801 Travilah Road Potomac, Maryland 20854 United States Tel: 301-610-6689 Fax: 240-363-0201 iPSC derivation from PBMCs using STEMCCA lentivirus or Sendai virus For this service we require 8 ml of freshly collected blood in CPT tubes (BD Biosciences – Cat# 362760) or other heparinized or EDTA tubes. Establishment of stable lentivirus-transfected cell lines Lentivirus-based shRNA was used for gene knockdown of human Rab8A, mouse/human Rab10, mouse/human RILPL1 using pLKO or pSIH-GFP vector. EP1748067A1 EP05291627A EP05291627A EP1748067A1 EP 1748067 A1 EP1748067 A1 EP 1748067A1 EP 05291627 A EP05291627 A EP 05291627A EP 05291627 A EP05291627 A EP scriptase subunit (hTERT) through interactions with its RNA binding domain 4 and carboxyl-terminal RGG domain, and this interaction is critical for the nucleolar localization of human TERT. No hTERT expression was detected in untransduced hMSC. lentiviral vectors carrying the human telomerase catalytic subunit (hTERT) and/or the human papillomavirus type 16 (HPV16) E6 and E7 oncogenes. 45-μm filter, then applied to hTERT-RPE1 cells. Immunization of HLA-A*0201 transgenic HHD mice with recombinant lv-hTERT vector induces potent and diversified cytotoxic T lymphocyte responses that recognize in vitro murine tumor cells, which In a separate group, lentiviral vector–transduced FH‐hTERTs were first encapsulated in commercially available Matrigel, and then the Matrigel‐encapsulated FH‐hTERTs were injected into the omentum. NEW! FectoVIR ® -AAV transfection reagent is a novel class of transfection reagent specifically designed to increase recombinant AAV production in suspension cell systems. HEL-TERT cells were transduced with filtered lentiviral stocks and two days later placed Lentiviral producing rtTA (Tet-On 3G) were generated after transfection of the pLVX-EF1a-Tet3G plasmid using the viral packaging mix (Clontech, Mountain View, CA, USA) in HEK293T cells. 5μg shRNA expression plasmids and 5. Adenovirus Production. The efficiency of hTERT silencing was verified with qPCR, Western blot, and immunofluorescence staining The hTERT OmicsLink™ ORF lentiviral expression plasmid (GeneCopoeia Cat. The human telomerase reverse transcriptase (hTERT) sequence was inserted into the TRIP. 00 Retroviral Packaging Mix: P905P: 200 μl $ 479. We found that hTERT was incapable of prolonging the replicative capacity of CB cells maintained under serum-free conditions in the presence of stem cell factor, Flt3 ligand, thrombopoietin, and inter- YAP transcriptionally activates the hTERT promoter by interacting with TEAD. 5×106293T cells were transfected with 2. A lentiviral vector carrying SV40T, hTERT, or the human papilloma- virus type 16 (HPV16) E6 and E7 (E6/E7) viral oncogenes, was introduced into CD36 + EPCs, singularly or combined. You should also be using 3rd generation vectors, this will increase the safety of the system. Tai, M. Lentiviral vectors are also favorable for biological research and gene therapy trials due to their ability to infect both dividing and nondividing cells and are particularly suitable for BMSCs . After construction of the recombinant adenovirus plasmid pAd-pshuttle-cmv-hTERT, human PDL cells were infected by packaged Furthermore, lentivirus-mediated overexpression of hTERT in fully senescent H-Ras G12V –expressing cells potentiated escape from OIS, demonstrating that hTERT expression and increased telomerase activity in senescent cells are a driver, and not a consequence, of senescence escape (Fig. Chumakov. 72 3. Immunologic analysis supports that hTERT is a widely applicable target recognized by T cells and can be potentially studied as a broad cancer immunotherapeutic, or a unique line of defense against tumor recurrence. Hdh Q111 cells were shifted to 39 °C 14 days prior to lentiviral infection. WT MEFs were cultured to passage 9–10 whereupon cells were counted every 3–4 days 14 days prior to lentiviral infection. HOX transcript antisense RNA (HOTAIR) was expressed in healthy dermal fibroblasts by lentiviral induction employing a vector containing the specific sequence. TetIIP-EGFP-/Ubi-TetR (Genechem, GV347). H9 cells were transfected with lentiviral particles and protein expression in shControl and shCXCR2 cells was measured by western blotting for cells cultured in (A) hPCCM or (B) mTeSR1. The issue with using (log ratio) increases in hTERT-overexpressed U2OS cells. B. You can use + symbol to restrict results containing all words. Figure Legend Snippet: (A) Plasmid chart of pLenti6/V5-hTERT (lentiviral expression construct). 22 Although several suc-cessful studies using the hTERT promoter in tumor-tar-geting gene therapy have been conducted, using the When packaging lentivirus with your gene of interest, it is important to bear in mind three main considerations: safety, titer, and flexibility. As shown by the strongly reduced expression of S-phase and G2/M markers (MCM2, pS10H3), the majority of irradiated control cells stopped proliferating, as expected. We transduced mouse cortical astrocytes cultured from four litters of embryonic wildtype (WT) and connexin43 (Cx43) null mouse pups with lentiviral vector encoding hTERT and measured expression of astrocyte-specific markers up to passage 10 (p10). 2012, 30(4): 747-754. 29 Western blots were performed using 40 μg protein lysates. , (2007) U-937 Claudia Scholl et al. In this study, we used a lentiviral vector system to target human telomerase reverse transcriptase (lv-hTERT), a widely expressed tumor antigen. 00 Lentivirus 10X Titer-Up Reagent (Titer Enhancer) P906: 1 ml $ 269. Remove culture medium from the cells, and add the Lentivirus/Polybrene mixture. Preclinical pharmacology and toxicology study of Ad-hTERT-E1a-Apoptin, a novel dual cancer-specific oncolytic adenovirus. Indeed, telomerase has recently been heralded as a potential mechanism to reverse aging. To obtain the most efficient knockdown siRNA, shRNA-bearing lentiviral vectors were used. Untransduced cultured tenocytes show only a background level of telomerase activity, but it was significantly increased by hTERT transduction. HTERT is the catalytic subunit of telomerase which plays crucial roles in the cells' unlimited replication (29–31). The effect that TERT expression has on the innate antiviral response to RNA- and DNA-containing viruses has not been examined. , (2007) THP-1 Claudia Scholl et al. After lentiviral transduction of hMSCs, four clones (SCP-1, -9, -11 and -12) were isolated by single cell picking. Growth Properties Reprogramming fibroblasts using lentiviral method. (PMID: 17921507) Van Laer L … NeuroMag Transfection Reagent is the first dedicated Magnetofection™ transfection reagent for neurons from 1 DIV to 21 DIV. 5 pg pRL-TK control along with either 50 pg SUPER TOPFLash or 50 pg mutated FOPFLash and with either 10 pg empty vector or 10 pg pcDNA3-FLAG-hTERT using X CONCLUSION: A lentivirus RNAi vector targeting hTERT gene was successfully constructed, which decreased the expression of hTERT and telomerase activity effectively and induced apoptosis. Second-generation lentiviral particles were generated using a three-vector system including transfer vector pLV-hTERT-IRES-hygro, and human telomerase reverse transcriptase (hTERT) lentivirus was utilised to establish stable hygromycin-resistant equine embryonic cell lines. Construction of CSII-CMV-cyclin D1, -CDK4R24C and -hTERT was described previously. ( C-F ) HTERT localization in MSCs. The wild-type (wt) 3′ UTR sequence or mutant (mu) 3′ UTR sequence of hTERT was cloned into a luciferase reporter Therapeutic efficacy of an hTERT promoter-driven oncolytic adenovirus that expresses apoptin in gastric carcinoma. The percentage of GFP-positive cells was determined over time by flow cytometry. The lentiviruses were concentrated by ultra-centrifugation. We designed a pair of complementary short hairpin In this study, we examined the therapeutic effects of NIS gene under the control of tumor-specific human telomerase reverse transcriptase (hTERT) promoter using 188Re in vivo. IRES green fluorescent protein (GFP) lentiviral vector between the BamHI and EcoRI cloning sites. Lentiviral supernatants containing hTERT or control HPV vector were a generous gift from Dr. , (2007) U343MG R Vasilcanu et jetOPTIMUS® is a best-in-class DNA transfection reagent, based on a novel cationic nanotechnology allowing high efficiency with low volume of reagent. Pelleted lentiviruses were resuspended in complete REGM/REBM. A 9-week-old human fetal pancreas was simultaneously transduced with both lentiviral vectors and trans-planted under the kidney capsule of a recipient SCID mouse. Deng, Jing-jun Zhang and Zhi-heng Liu 1. 2)Untersuchung der biologischen Effekt einer lentiviralen Transduktion von hTERT auf hMSCs. Europe PMC is an archive of life sciences journal literature. We designed a pair of complementary short hairpin with the hTERT lentivirus or empty control lentivirus. Establishment of a clonal immortalized human mesenchymal stem cell line expressing hTERT using lentiviral gene transfer @inproceedings{Mutschler2012EstablishmentOA, title={Establishment of a clonal immortalized human mesenchymal stem cell line expressing hTERT using lentiviral gene transfer}, author={W. The present invention relates to polynucleotides encoding hTERT epitopes restricted to MHC class I molecules, their analogs, and polyepitopes containing said epitopes and / or analogs. hTERT is absent in most human somatic cells due to transcriptional repression soon after embryogenesis (Liu et al. Upon macrophage-like differentiation of the transduced HL-60 cells by dimethyl sulfoxide, up to 28% of the cells had higher mean levels of superoxide production than undifferentiated cells, and lentivirus efficiently transduced cells Human hTERT cDNA, including full coding region [6], was cloned under CMV-promoter into lentivirus vector pLU-PL3 [7] were gifts from Dr. Thasler and M. Full-length cDNA of human telomerase reverse transcriptase isoform 1 (hTERT; GenBank accession number NM_003219) was amplified by PCR from the total RNA of In this study, by introducing lentivirus-mediated hTERT and VEGF genes to modify human BMSCs from aged donors, we observed extended lifespan, promoted angiogenic capacity while less enhanced tumorigenicity of the genetically engineering BMSCs. Mutschler and W. Each batch of cell immortalization kits were functionally tested in fibroblasts. BJ/hTERT fibroblast line immortalized with hTERT Homo sapiens CRL-4001 yes 90 minutes overnight BT549 Breast Cancer Homo sapiens 500 2. One disadvantage associated with lentiviral vectors is the insert size limitation. Therefore, lentiviral vectors, which potentially allow stable long-term transgene expression, are good candidates for gene delivery vehicles. 0 kb. For most lentiviral vectors developed, the maximum insert size is 5. 25 µg) into Lenti-X 293T cells (Takara Bio, Inc. Lenti ORF particles, TERT (mGFP-tagged) - Human telomerase reverse transcriptase (TERT), transcript variant 1, 200ul, >10^7 TU/mL Unfiltered lentivirus produced by suspension cells using the LV-MAX Lentiviral Production System was compared with polyethylenimine (PEI)–mediated transfection of lentiviral vectors in adherent HEK 293T/FT cells and suspension HEK 293 cells. To create the novel cell lines characterized in detail, P1 or P2 cells were infected with a 50:50 mixture of lentiviral vectors expressing Bmi-1 and TERT (Myc-DDK-tagged)-Human telomerase reverse transcriptase (TERT), transcript variant 1 In brief, hTERT–RPE1 cells were transduced with lentivirus for 48 hr in duplicates, after which the cells of one duplicate were harvested (day 0) to extrapolate the baseline gRNA distribution. For many gene transfer applications First, we followed the irradiation of the hTERT-RPE1 WT cells by transduction with control or RCC1-V5–expressing lentiviruses . Concentrated lentivirus expresses human target, CD47, containing RFP fluorescent marker and Blasticidin selection. Lentiviral vectors (LVs) offer several advantages over traditional oncoretroviral vectors. Selection was continued until 72 h post-transduction, which was considered the initial time Takara Bio provides kits, reagents, and services that help researchers explore questions about gene discovery, regulation, and function. hTERT: heterogeneous hTERT-hMSCs, SCP: single-cell-picked hTERT-hMSCs. When cells that are infected with lentivirus survive, they undergo integration of the lentiviral genome, including the ~20 CRISPR targeting bases that have been cloned into the lentiviral genome. Recombinant hTERT calibrator: (500 ng/mL), 1 mL 3. hTERT mRNA and protein levels were determined in HEK293A cells transfected with empty vector or YAP expressing vectors as indicated. Recently, T cell immunotherapy studies have mainly focused on chimeric antigen receptor- and T Lentivirus vector plasmid of human MYC driven by Tet-responsive promoter and hKO1-2A-rtTA driven by CMV promoter. A, CD8 + T cells double gene-modified to express both HLA-A*24:02–restricted hTERT-specific TCR and CD16 on the cell surface were shown to be positive for both HLA-A24/hTERT tetramer and CD16, as enclosed by the dotted square. The hTERT gene was successfully transferred into tree shrew IECs using lentivirus and long-term stable expression of the gene was achieved. They are used extensively for creation of cell lines and for gene expression or knockdown as described in Sections 1. Excisable lentiviral vectors were constructed to express SV40 LT or hTERT under the control of a 405-nt fragment of the rat insulin-2 promoter. Moreover, the hTERT-ahMNCs had no gross chromosomal abnormalities on a karyotype analysis. GFP-transduced HA-5 cells underwent crisis as expected, whereas hTERT-transduced cells were im- Lentivirus was made by transfecting 3 μg of pLenti4/V5‐hTERT expression plasmid and 12 μg of viral packaging vectors (Packaging Mix, Invitrogen) into 293FT cells (Invitrogen) by lipid transfection (Transfectin, Bio‐Rad, Hercules, CA, USA). 2 and 3. The ensuing bi-cistronic construct contains the full-length hTERT coding sequence under the control of the human cytomegalovirus immediate early promoter (CMVie), followed by the encephalomyocarditis virus internal ribosome entry site (IRES) and the enhanced green fluorescence protein (EGFP). Full-length cDNA of human telomerase reverse transcriptase isoform 1 (hTERT; GenBank accession number NM_003219) was amplified by PCR from the total RNA of a colon cancer cell line. It is ready-to-use for transduce almost all types of cells, dividing or non-dividing, and obtain stable cell lines in about 3 days. hTERT-Immortalized Bone Mesenchymal Stromal Cells Expressing Rat Galanin via a Single Tetracycline-Inducible Lentivirus System Figure 2 Plasmid profile of the single tetracycline-inducible lentiviral backbone vector system pLV. Lentiviral vector and heat-induced expression of EGFP expression under the control of the 8HSEs-hTERT promoter in cultured cells and mouse tumour xenografts was measured by reverse transcription polymerase (RT-PCR), Western blot and immunofluorescence assays. com 1. SPT6‐targeting short hairpin RNAs (shRNAs) and control shRNA plasmids were purchased from GeneCopoeia. Knockdown of KRT23 inhibited the proliferation and migration in LoVo The hTERT‐expressing lentivirus (lenti‐hTERT) conferred robust telomerase activity on S‐WI cells, whereas S‐WI cells infected with lenti–GFP were devoid of telomerase activity . The lentiviral vector was co-transfected with packaging vectors psPAX2, pMD2 VSV-G in HEK293T cells using PEI. The infection was mediated by lentivirus following the kit's protocol (Lenti‐Pac HIV expression packaging kit, GeneCopoeia). 1。SEQ ID No. We measured hTERT mRNA and protein expression in NB4 cells transduced with GFP hsa-miR-138- and GFP-expressing lentiviruses (blank). 00 Retrovirus Packaging Kit: P905: 10 rxn $ 579. After the primary cells experience limited population proliferation during the culture process, the primary cells cease to proliferate. PDL cells were infected at passage one with the hTERT lentivirus (Multiplicity Of Infection (MOI): 5x104) and selected with 10 μg/ml blasticidin for seven days. Concentrated lentivirus expresses human target, CD47, containing RFP fluorescent marker and Blasticidin selection. 4 × 10 6 293FT cells were seeded into 10‐cm tissue Lentiviruses were harvested 24 and 48 h after transfection and filtered through a 0. . The biggest concern is the possibility of generating replication-competent lentivirus through crossover events between elements in the viral vector and the packaging cell line. ( C-F ) HTERT localization in MSCs. The concentrated lentiviruses were resuspended in 1 mL of PBS. Qi, Y. ( 2014 ). (PMID: 19015635) Kang X … Park NH (Oncogene 2009) 3 4 23; The grainyhead like 2 gene (GRHL2), alias TFCP2L3, is associated with age-related hearing impairment. G. After infection with lenti-hTERT and corresponding control lentivirus, the above cells were seeded in 12 wells. 3 and 1. RPTE cells at passage 3 were grown in REGM/REBM medium in a 10-cm dish. The titer of the lentivirus was measured by qRT-PCR titration kit. Lentivirus-mediated expression of Drosophila melanogaster deoxyribonucleoside kinase driven by the hTERT promoter combined with gemcitabine: a potential strategy for cancer therapy. , Coralville, IA, USA) and Qian et al , we selected 5′-TGGTGGATGATTTCTTGTT-3′ as the target sequence. Streptavidin-HRP: 1 mL 7. Application: stable cell immortalization Exemplary GOI: SV40LT, BMI1, hTERT, C-MYC, L-MYC, HRAS Order: customized product To package lentivirus, HEK293T cells were co-transfected using Lentifectin (ABM, USA) with the lentiviral vector and packaging vectors psPAX2 and pMD2. S4C). Twenty-four hours later, cells were harvested for qPCR analysis. Wash solution concentrate: (20X), 25 mL 4. lentiviral vectors recombinant adeno-associated viral (rAAV) vectors to deliver human telomerase reverse transcriptase (hTERT) into ovine or HNP cells to prolong the activity of nucleus pulposus cells with limited success. Mix 8 µl Polybrene (1 mg/ml aliquot) with 957 µl culture. K5+/K19+ hTERT-Immortalized Human Mammory Stem/Progenitor Cells Lentiviral titers were measured 48 and 72 hours post-transfection (Data kindly provided by Genethon). ) (2 × 10 6 cells/60-mm dish) using the TransIT-293 transfection reagent (Takara Bio, Inc. pLKO-puro-scramble or pSIH-GFP-scramble was used as control. Each batch of cell immortalization kits were functionally tested in fibroblasts. POT1 is a 3′ telomeric single-stranded overhang binding protein that has been implicated in chromosome end protection, the regulation of telomerase function, and defining the 5′ chromosome terminus. Regulation of the hTERT promoter activity by MSH2, the hnRNPs K and D, and GRHL2 in human oral squamous cell carcinoma cells. We found that hTERT was incapable of prolonging the replicative capacity of CB cells maintained under serum-free conditions in the presence of stem cell factor, Flt3 ligand, thrombopoietin, and interleukin-3 beyond 4 months (n=3). 3)Aufklärung des Transformationspotenyials von hTERT-transduzierten hMSCs. , the potential for producing oncogenic viruses or replication-competent lentivirus (RCL), can be greatly mitigated by carefully considering the nature of the transgene insert and by ensuring that viral replication is restricted to specific packaging cells that provide these essential functions, in trans. To further determine the roles of Sp1 family TFs in regulating hTERT promoter activity, the endogenous expression of Sp1 and Sp3 was knocked down by lentiviral shRNAs. len·ti·vi·rus·es Any of a group of retroviruses of the genus Lentivirus that cause diseases with a long latent period and a slow, progressive course . An The hTERT‐expressing lentivirus (lenti‐hTERT) conferred robust telomerase activity on S‐WI cells, whereas S‐WI cells infected with lenti–GFP were devoid of telomerase activity . Cells receiving this second transduction with hTERT were then again transplanted into SCID mice. Thus, in the present study, using a lentiviral system, we introduced the immortalization gene, hTERT, into primary rat BMSCs. lentivirus vectors expressing either hTERT or GFP. The relatively weak signal of c-Myc binding was likely due to the In this study, by introducing lentivirus-mediated hTERT and VEGF genes to modify human BMSCs from aged donors, we observed extended lifespan, promoted angiogenic capacity while less enhanced tumorigenicity of the genetically engineering BMSCs. , (2007) TOV112D Jiangyong Miao et al. It has set up a research platform for the gene therapy of tumors which take hTERT as the target. 2 we However, the use of hTERT alone is not sufficient to immortalize hMSCs, requiring the combinatorial expression of human papillomavirus type 16 genes (HPV16) E6 and E7 [29]. Immortalized Human Mammary Epithelial Cell Line-hTert were selected from Human Mammary Epithelial Cell resistant to puromycin after infected with hTert expressing lentiviral particles. This restored endocrine properties of hTERT-modi˜ed cells in vitro. As revealed by our flow cytometric analysis, hTERT-MSCs bearing lentiviral constructs retain their mesenchymal origin, as was confirmed by the expression of CD44 and CD73 by more than 95% and 94% The aims of this study were to generate periodontal ligament (PDL) cells that have adenovirus- or lentivirus-mediated overexpression of human telomerase reverse transcriptase (hTERT) and to compare the osteogenic and proliferative abilities of the two cell lines to establish an efficient and stable cell model that will be more suitable for studies of PDL regeneration. The re-spective transfected cells were continuously passaged for >20 passages, at which point the cells infected with the control len-tivirus had reached senescence (at passage 5–10), whereas the growth rate of the hTERT-infected cells had accelerated and the culture continued to grow. Our goal was to noninvasively measure chemotherapy-induced changes in the expression of critical tumor growth genes. The titer of the lentivirus was measured by qRT-PCR titration kit. recombinant lentivirus Lenti-hTERT-Fth1-3FLAG-Puro in which the hTERT promoter was used to direct the expression of the modified Fth reporter gene, and then the recombinant vectors were transduced into cells in vitro and injected into tumour models in nude mice. 7所示的hTERT基因模板的上游引物,以及SEQ ID No. . 1. As expected, lentiviral shRNAs against c-Myc, Max, USF1 and USF2 significantly reduced the binding of each of these proteins to the hTERT core promoters in the transgenic (Figure 6A) and endogenous (Figure 6B) loci, as determined by ChIP and quantitative PCR (qPCR) analyses. For lentivirus transduction, Tax and green fluorescent protein (GFP) coding sequences were cloned into the HIV-based lentivirus pHRCMV between BamHI and XhoI, and pseudotype viruses were produced as previously reported. Given that hTERT immortalisation of vHMECs only resulted when lentivirus infection took place in young cells (PD20), we were concerned about the possibility of immortalising p53-deficient vHMECs. 3. Lentiviral vectors can thus be used safely and are extremely useful tools for one-way transfers of exogenous Background Human telomerase reverse transcriptase (hTERT), the catalytic subunit of telomesase, is responsible for telomere maintenance and its reactivation is implicated in almost 90% human cancers. Here, we report a real‐time and noninvasive method to monitor tumor response to a lentivirus‐based hTERT‐conditional suicidal gene therapy. Full‐length mouse Sting gene was cloned into the lentiviral vector pCDF1‐CMV‐MCS2‐EF1‐copGFP (CD111B‐1; System Bioscience) to make the expression constructs LV‐Sting. (C)hTERT mRNA expression was detected by qPCR. Skip to content For product queries: Call 1-858-678-8683 or email at info@gentarget. 5 8. Figure Legend Snippet: (A) Plasmid chart of pLenti6/V5-hTERT (lentiviral expression construct). Construction of shRNA-directed hTERT-expressing plasmid Following a searching for the hTERT mRNA sequence in GenBank, according to RNAi design software (Integrated DNA Technologies, Inc. No. 1 mg/ml), and immunoprecipitated (IP) with anti-Flag, followed by immunoblotting (IB) with the indicated antibodies. This service takes three months to complete and includes: Fibroblast expansion, mycoplasma testing, freezing vials and plating for transduction. Methods: Whole RNA was extracted from 293T cells. A little guide for advanced search: Tip 1. ) at a 1:3 ratio using Lipofectamine™ reagent (Invitrogen). Full-length cDNA ofhuman telomerasereverse transcriptaseisoform1 (hTERT; GenBank accession number NM_003219) was Recombinant lentivirus preparations Recombinant lentiviruses were prepared using the ViraPower Lentiviral Expression System (Life Technologies), according to the manufacturer's instructions. Forty-eight hours after transfection, the virus-containing supernatant was harvested and stored in aliquots at −80 °C. G) by calcium phosphate transfection into HEK293T cells. hTERT: heterogeneous hTERT-hMSCs, SCP: single-cell-picked hTERT-hMSCs. This feature is used in CRISPR screening as follows. Optionally, perform a spinoculation The high frequency of hTERT -promoting mutations and the increased expression of hTERT mRNA in anaplastic thyroid cancer (ATC) make TERT a suitable molecular target for the treatment of this lethal neoplasm. The hTERT-overexpressing lentiviral vector was co-transfected with the VSVG and PAX2 lentiviral packaging vectors into HEK293FT cells (Invitrogen, Carlsbad, CA, USA). It has proven to be extremely efficient in transfecting a large variety of primary neurons such as cortical, hippocampal, dorsal root ganglion and motor neurons with all types of nucleic acids. 0 2 yes 30 minutes >70% infection overnight C2C12 Myoblast Mus musculus CRL-1772 yes 30 minutes <40% but useable overnight A lentivirus expression plasmid contains the CMV promoter to drive the expression of gene of interest followed by mulitple cloning site and the PGK promoter to drive puromycin resistance. Lentivirus- Lentiviral vector plasmids encoding the designed hairpins against hTERT gene were derived by cloning into pLV-THEM-GP1 lentiviral vector, which expresses the GFP gene under control of the H1 Lenti-hTERT virus CIP-0020 Lentiviruses for Gene-Specific Immortalization Cell Immortalization Products hTERT up-regulates VEGF expression in HeLa cells through Sp1 activity. Lentivirus Production. Enhancer of zeste 2 (EZH2) was blocked with GSK126 inhibitor. This restored endocrine properties of hTERT-modified cells in vitro. Recent evidences show that hTERT is essential for neoplastic transformation independent of its canonical function. In this study, we encapsulated an anti- hTERT oligonucleotide in biocompatible nanoparticles and analyzed the effects of this novel pharmaceutical preparation in preclinical models of ATC lentiviral vectors (described below) expressing Bmi-1 or hTERT or with a control vector expressing GFP or were sham infected as indicated, all in the presence of 2 g/ml polybrene. And then, the supernatants were collected on days 2, 3, and 4. A value for P < 0. If the p53 loss and immortalisation events occur prior to attaining critically short telomeres, it is probable that p53 loss may not necessarily confer genomic instability. , 2010). The vector has the CMV promoter for driving constitutive expression of the target gene and the blasticidin sele Recombinant lentiviruses are derived from HIV-1, so certain precautions must be taken to ensure its safe use in gene delivery. We show that the resulting HEL-TERT cell line is capable of replicating beyond 100 population doublings without exhibiting signs of senescence. In the current study, we introduced the human TERT (hTERT) gene into a primary human embryonic lung (HEL-299) cell strain, which is known to respond to the type I IFN, IFN-β. No. We have created a modified gateway lentiviral system for shRNA and Cre/lox inducible gene expression with entry and destination vectors that are compatible with existing gateway technologies. hTERT-expressing lentivirus at a multiplicity of infection (MOI) of 0. IRES green fluorescent protein (GFP) lentiviral vector between the BamHI and EcoRI cloning sites. So, exploring the underlying mechanism of radioresistance, and find potential target, well deserve fully emphasis. High levels of human telomerase reverse transcriptase (hTERT) are detected in more than 85% of human cancers. In this study, we demonstrate that YAP transcriptionally acti-vates hTERT expression through interaction with TEAD, and thereby regulates telomerase activity and telomere buffered saline, and lentivirus was concentrated by centrifuging at 24,000rpm for 2 h (AH-629 rotor). GFP-transduced HA-5 cells underwent crisis as expected, whereas hTERT-transduced cells were immortalized and exhibited telomere elongation (data not shown). Additionally, recently developed self-inactivating (SIN) LVs allow promoter-specific transgene expression. CHO Cell Antibody Production. Quality Control: 1) Cell markers were probed via immunohistochemical analysis; 2) Soft agar assay preformed to determine anchorage-independence. Two types of tumorigenic cell‐targeting lentiviral vector plasmids (pTC‐LVs), which have each promoters upstream of Venus‐2A‐HSVtk, were ultimately generated using the each pPSs and the same pLVA (V‐Tk) to test the feasibility of this system for this study. To achieve this goal, we used radionuclide and optical methods to measure changes in human telomerase reverse transcriptase (hTERT) gene expression in tumor cells before and after 5-fluorouracil treatment. . At Besides its canonical function of catalyzing the formation of telomeric repeats, many groups have recently reported non‐canonical functions of hTERT in particular, and telomerase in general. Growth kinetics. Objective: To construct a cell line of oral mucosa epithelial cells that stably express human telomerase reverse transcriptase (hTERT) by lentiviral vectors, approaches for the establishment of stable and efficient immortalized oral mucosa epithelial cell lines were explored. 00 Lentivirus 10X Titer-Up Reagent (Titer Enhancer) P906S: 0. 7 Lentiviral TRIPZ-shALDH1A3 pools exhibit significant ALDH1A3 knockdown as compared to TRIPZ-Control pools . AAV Production. Skip to content For product queries: Call 1-858-678-8683 or email at info@gentarget. Recently, HTERT is often maladjusted, which is considered as a cancer hallmark and a potential therapeutic target (30, 31, 33). SOURCE C23 (D-6) is a mouse monoclonal antibody raised against amino acids . resistance genes. The aims of this study were to generate periodontal ligament (PDL) cells that have adenovirus- or lentivirus-mediated overexpression of human telomerase reverse transcriptase (hTERT) and to compare the osteogenic and proliferative abilities of the two cell lines to establish an efficient and stable cell model that will be more suitable for studies of PDL regeneration. (B) hTERT mRNA was detected in hTERT-transduced hMSCs. The tax coding sequence was cloned into the HRCMV When Tax-transduced T cells were maintained longer (8 weeks) lentivirus vector, and pseudotype virus particles were produced to in culture, in the presence of IL-2, hTERT mRNA expression was transduce the tax gene into primary T cells. LV‐Empty or LV‐Sting vector was co‐transfected into HEK293T cells with the pPACKF1 Packaging plasmids mix Lentivirus is usually a BSL 2, and My understanding is the oncogenic risk is only really if you are working with an oncogene on your transfer plasmid. GFP-transduced HA-5 cells underwent crisis as expected, whereas hTERT-transduced cells were im- The literature data thoroughly describing the effect of hTERT gene silencing using either siRNA or lentiviral vectors as shRNA carriers for head and neck cancer are limited, and do not indicate To confirm that hTERT was functional when expressed from the lentivirus construct, we infected simian virus 40-transformed HA-5 cells with hTERT or GFP. 5. No. Culture Corpus ID: 34877239. ) according to the manufacturer’s instructions. 45-μ m filter. However, clinical outcome heavily be hindered by radioresistance. Lentiviral Vectors Retroviral and lentiviral vectors are key components of the hAE research toolbox and their production by individual laboratories is within reach for many investigators. Results Ectopic expression of hTERT in hMSCs Lentiviruses containing the gene of hTERT were generated from the lentiviral expression construct pLenti6/V5‐hTERT ( Fig. will integrate into a host cell genome once inside the nucleus. (Myc-hTERT) and Flag-PES1 or Flag-DKC1 were treated with or without RNase A (0. Immortalized cells are derived from primary cells: exogenous immortalized genes (EBV, HPV E6 / 7 and SV40 T antigens of recombinant lentivirus, retrovirus & adenovirus, hTERT, p53) are introduced into target cells by gene transfection technology and At present, refractory and relapse are major issues for leukemia therapy and a major cause of allogeneic hematopoietic stem cell transplant failure. A and B, YAP induces hTERT expression in a TEAD‐dependent manner. In this study we evaluated a recombinant lentiviral vector expressing the human telomerase reverse transcriptase (lv-hTERT) vaccination in the humanized HLA-B*0702 transgenic (HLA-B7 Tg) mice. To verify whether the 3′ UTR of hTERT mRNA was a target of miR-1182 in 293T cells, a luciferase reporter gene assay was used. The hTERT promoter-driven luciferase and telomerase activities were significantly activated by lentivirus (Figures 3g and h). Seeding transduced fibroblasts on irradiated MEFs. By contrast, pBabe‐hTERT, which requires cell proliferation for integration and expression, failed to confer telomerase activity on S‐WI cells, although Our e-newsletter is a great way to stay up to date on the most recent news and products from Cell Biolabs. You can use quotes "" to search for an exact expression. Diluent buffer concentrate: (5X), 25 mL 5. Lentiviral stocks were prepared essentially as described above for pMX-hTERT-hygro with the inclusion of the lentiviral packaging vector, psPAX2 (Addgene plasmid 12260) during lentiviral stock preparation. The medium in m onolayer culture of NSC was removed and cells washed twice with PBS. A single lv-hTERT vector immunization induces potent and broad HLA-B7-restricted CTL responses against hTERT. TMB substrate solution (TMBA and TMBB): 6 mL & 6 mL 8. 5 × 10 5 cells/mL were infected at a multiplicity of infection equal to 50 in the presence of 4 μg/mL Polybrene in complete culture medium. 4. Primary human fibroblasts express low levels of catalytically active hTERT in an S The most well-known immortality gene is Telomerase (hTERT). hTERT-Immortalized Bone Mesenchymal Stromal Cells Expressing Rat Galanin via a Single Tetracycline-Inducible Lentivirus System To determine the role of PRMT1 in NSCLC migration, we down-regulated the PRMT1 expression in the NSCLC cell line A549 via a lentiviral vector-mediated small hairpin RNAs (shRNAs). CHROMOSOMAL LOCATION Genetic locus: NCL (human) mapping to 2q37. Lentivirus Packaging Mix: P904P: 200 μl $ 479. InSections 2. com Lentiviruses were produced by cotransfection of HEK293T cells with recombinant lentivirus vectors and pPACK Packaging Plasmid Mix (System Biosciences) using MegaTran reagent (Origene) and were used TargetScan online software demonstrated that hTERT was a candidate target of miR-1182 (Figure 6C). 35 The recombinant lentiviruses with the vesicular stomatitis virus G glycoprotein were produced as described To immortalize hPrEC, cells were cotransduced with lentiviral pLV-hTERT-IRES-hygro (Addgene#85140) and lentiCRISPRv2-sgCDKN2A targeting exon 2 of CDKN2A (GTGCACGGGTCGGGTGAGAG) and selected with 25 Recombinant lentivirus preparations Recombinant lentiviruses were prepared using the Vira-Power Lentiviral Expression System (Life Technologies), according to the manufacturer’s instructions. Our lentiviral systems provide a superior level of all three: Safety: Our ViraSafe™ Lentiviral Expression Systems are specifically engineered to minimize the chance of making replication-competent lentivirus (RCL). Lentiviruses containing the gene of hTERT were generated from the lentiviral expression construct pLenti6/V5-hTERT (Fig. Lentiviral synonyms, Lentiviral pronunciation, Lentiviral translation, English dictionary definition of Lentiviral. lentivirus is able to express green fluorescent protein (GFP) specifically in telomerase-positive tumors; these studies have provided high-quality fluorescence images of tumors using an optical camera. Cas9 expressing cells were transduced with a lentivirus encoding GFP and sgRNAs. (B) The protein levels of VEGF, hTERT and Actin were determined by immunoblotting. Cell types shown to be transduced by TRC library lentivirus last updated September 2008 Cell Line Name Reference RD Tsan-Chi Chen et al. Moreover, transplantation studies in immunode˜cient mice veri˜ed the capacity of these Search Results for Shrna Directed Htert Expressing Plasmid on Bioz, providing objective ratings for all products used in life science research. C. Then all these devices were packed into lentivirus and the results of quantitative real-time PCR showed that the mRNA expression level of HRAS was selectively inhibited in the T24 and 5637 cells. After shRNA transfection, we selected against noninfected cells using puromycin for 1 week. 3 a and 4 . The human telomerase reverse transcriptase (hTERT) sequence was inserted into the TRIP. Ready-to-Use Lentivirus Markers/Supernatants has developed a unique in-house technology to produce highly purified and concentrated Lentiviral supernatant carrying markers, gene or shRNA of interest. 3. Results: hTERT promoter activity was higher in SW480 cells than in MKN28 or MRC-5 cells. Each batch of cell immortalization kits were functionally tested in fibroblasts. your cell life span before hTERT gene transduction. Transduction of 1 well (100,000 cells/well) with lentivirus OSKM-dTomato. ST. Therefore, primary hMSCs were infected with HPV16 E6-E7 and hTERT lentiviral vectors expressing pSin hTERT and pSin E6-E7 [ 30 ] using a multi-infection program, as reported 具体地,hTERT基因模板的序列参照GenBank数据库中登录号NG_009265. Our lentiviral systems provide a superior level of all three: Safety: Our ViraSafe™ Lentiviral Expression Systems are specifically engineered to minimize the chance of making replication-competent lentivirus (RCL). The primary cells can also be immortalized by over-expression of various viral genes like the large T-antigen of the simian virus (SV40) or human telomerase reverse transcriptase (hTERT). , Coralville, IA, USA) and Qian et al , we selected 5′-TGGTGGATGATTTCTTGTT-3′ as the target sequence. 35) and puromycin-containing medium was added the next day to select for transductants. hTERT-Immortalized Bone Mesenchymal Stromal Cells Expressing Rat Galanin via a Single Tetracycline-Inducible Lentivirus System. 0. , Ltd. e. The results of qRT-PCR experiments showed that hTERT mRNA was detectable in TIECs but not pTIECs, which is in line with the results of Wang et al. International journal of molecular medicine. By contrast, pBabe‐hTERT, which requires cell proliferation for integration and expression, failed to confer telomerase activity on S‐WI cells, although The packaged slow vector construct is provided as frozen VSV-G pseudotype virus particles. Construction of shRNA-directed hTERT-expressing plasmid Following a searching for the hTERT mRNA sequence in GenBank, according to RNAi design software (Integrated DNA Technologies, Inc. 2. Although nuclear import of telomerase transcriptase (hTERT) is required for telomerase activity to elongate telomeres in vivo, the molecular mechanism regulating nuclear localization of hTERT is unclear. Methods We constructed two lentiviral vectors under the control of hTERT promoter respectively expressing NIS or enhanced green fluorescent protein (EGFP). Here we developed a lentiviral vector bearing both hTERT and a gene encoding green fluorescence protein (L-hTERT/EGFP). It has been reported that hTERT mRNA is overexpressed in AML patients , and it has been shown that hTERT is necessary to prevent apoptosis, and induce cell proliferation (15, 29). Recent findings have implicated HTERT in various human diseases, including cancer (17, 30, 32). 3 was directly added Effect of hTERT Gene Expression on Proliferation and Apoptosis of Cervical Cancer Caski Cells by Lentivirus-Mediated Small Interfering RNA: MO Ling-zhao 1&, LI De-quan 1&, XIA Yu 1, CHEN Chang-xian 1, PANG Xiao-fen 1, LING Dan 2 Sustained cell proliferation requires telomerase to maintain functional telomeres that are essential for chromosome integrity and protection. The human telomerase reverse transcriptase (hTERT), the rate‐limiting component of telomerase, is expressed in most malignant tumors, but it is not found in most normal somatic cells. 1 ml For lentivirus infection, lentivirus was packaged by cotransfection of L13-Arl13bGFP construct with the packaging and envelope plasmids (psPAX2 and pMD2. The hTERT gene was amplified by polymerase chain reaction (PCR) and cloned into the lentiviral vector as pLVX-puro-hTERT. pl. To confirm that hTERT was functional when expressed from the lentivirus construct, we infected simian virus 40-transformed HA-5 cells with hTERT or GFP. In brief, the package cells were transfected with plasmids/EndoFectin Lenti complex for 48 h. Primary human hepatocytes were transduced with lentivirus-mediated catalytic subunit of human telomerase reverse transcriptase (hTERT) to establish IHH. The infection was mediated by lentivirus andconductedaccordingtothemanufacturer'sprotocol(Lenti-PacHIV expressionpackagingkit,GeneCopoeia). when a pancreas-duodenal homeobox (Pdx)-1 transgene was expressed in hTERT-modi˜ed cells with a lentiviral vector, along with inductive signaling through activin A and serum deprivation. The cells at 28 days after transduction were examined in western blot analysis as in Figs. 4 × 10 6 293FT cells were seeded into 10‐cm tissue culture plates 8 hrs prior to transfection and the medium was replaced 16 hrs after the transfection. Effect of targeted silencing of hTERT mRNA by lentivirus-mediated siRNA on A549 lung cancer cells in vitro. 1A). EX-hTERT-Lv156) was constructed using GeneCopoeia proprietary RecJoin™ technology. As shown in Fig. Then the 1:2 mixture of the lentiviral stock containing 10 8 particles per ml and the growth medium For lentiviral production, the GV166-TERT or control plasmid was co-transfected into 293FT cells with Lenti-Easy Packaging Mix (GeneChem Co. , 2010). Our mission is to develop high-quality innovative tools and services to accelerate discovery. After lentiviral transduction of hMSCs, four clones (SCP‐1, ‐9, ‐11 and ‐12) were isolated by single cell picking. The sequence of 5’-TTCTCCGAACGTGTCACGT-3′ was used to generate lentivirus expressing shRNA targeting human RIF1, viral infection was performed according to the direction for use provided by GenePharma. , (2007) SKM-1 Claudia Scholl et al. Sign Up Now The hTERT promoter-driven luciferase and telomerase activities were significantly activated by lentivirus (Figures 3g and h). MCF-7 and MDA-MB-231 cells were infected with the virus in the presence of 2 μg/ml polybrene. The cell lines stably expressed hTERT on RNA and protein level. Infected cells were examined by fluorescence microscopy and flow cytometry for the presence of proteins using fluorescent tags (GFP, green fluorescence protein; Fig 2: Expression pattern of overexpressed oncogenes or mutant p53 in KTB59-hTERT cells. However, a combinational expression of SV40 T antigen and hTERT or other genes have been shown to be effective in those cells (Matsumura 2004). Schieker}, year={2012} } The packaged slow vector construct is provided as frozen VSV-G pseudotype virus particles. The bioluminescent imaging of transplanted cells was conducted 1 day after cell transplantation and once a week thereafter for 8 weeks. There remains an urgent need to develop more potent hTERT vaccines 3. Lentivirus packaging and lentiviral transduction. In this study we evaluated a recombinant lentiviral vector expressing the human telomerase reverse transcriptase (lv-hTERT) vaccination in the humanized HLA-B*0702 transgenic (HLA-B7 Tg) mice. The lentiviral titer was determined by transducing HT1080 cells and analyzing GFP-positive cells. 8所示hTERT基因模板的下游引物 无引物二聚体,退火温度差距较小,且能够特异性的扩增hTERT基因模板,从而获得hTERT基 因标准品。 lentiviral gene transfer to ectopically express hTERT. MCF7 cell lysates were immunoprecipitated with anti-hTERT from Abbexa and immunoblotted with anti-hTERT from Abcam and C anti-PES1. lentivirus vectors expressing either hTERT or GFP. Relative hTERT protein levels were quantified with ImageJ software These were removed and transduced with lentivirus expressing hTERT. ( B ) Cas9 expressing MSS or MSI-H CRC cells were transduced with a lentivirus encoding GFP and sgRNAs targeting multiple domains in WRN as indicated. METHODS: hTERT-Immortalized Bone Mesenchymal Stromal Cells Expressing Rat Galanin via a Single Tetracycline-Inducible Lentivirus System. Several zeocin-resistant colonies were selected from each cell population for further characterization. No hTERT expression was detected in untransduced hMSC. For some primary cell types, it has been shown that over-expression of SV40 T antigen or hTERT alone is not sufficient for successful immortalization. Cells were seeded on 96-well microplates (655083; Greiner Bio-One), and each well was transiently transfected with 0. Through exogenous expression of human telomerase reverse transcriptase (hTERT) and murine cyclin-dependent kinase (mCdk4) using retroviral (and subsequently lentiviral) vectors carrying the hTERT and mCdk4 genes, normal (NF1 wild-type, +/+), neurofibroma-derived Schwann cells that were heterozygous (+/-) for NF1 mutation, and homozygous (-/-) for NF1 mutation, were immortalized. Example: "cell division" Tip 2. Human telomerase reverse transcriptase (hTERT) is an RNA-dependent DNA polymerase that synthesizes telomeric DNA at chromosomal ends to maintain telomere length (Liu et al. 05 was considered significant. Gamma secretase inhibitors were employed to block Notch signalling. (C-D) mRNA and protein expression of ITGB1 after knockdown of ITGB1. At 48 h after infection, VEGF mRNA levels were quantified by qPCR. The packaged slow vector construct is provided as frozen VSV-G pseudotype virus particles. (A) Lentiviruses targeting four different positions of Plk1 mRNA (nucleotides 183, 245, 367, and 1424 relative to the starting codon) were prepared as described in Materials and Methods and used to infect Ziel: 1)Etablierung einer immortalisierten hMSC-Zelllinie durch lentivirale hTERT-Transduktion. G plasmid, 8 μg of pCMVDR8. (B) hTERT mRNA was detected in hTERT-transduced hMSCs. When packaging lentivirus with your gene of interest, it is important to bear in mind three main considerations: safety, titer, and flexibility. LT001-01). Briefly, WI 38 cells at 1. , miR-342-3p regulates MYC transcriptional activity via direct repression of E2F1 in human lung cancer. Knockdown of KRT23 inhibited the proliferation and migration in LoVo The human telomerase reverse transcriptase (hTERT), the rate‐limiting component of telomerase, is expressed in most malignant tumors, but it is not found in most normal somatic cells. LT008) with the Lenti-Pac HIV Packaging Mix (GeneCopoeia Cat. After growing hTERT cells were infected with lentiviruses encoding mutant proteins. Concentrated lentivirus expresses human target, CD47, containing RFP fluorescent marker and Blasticidin selection. The invention provides lentiviral preparations containing a sulfonic acid buffer, such as 1,4-piperazinediethanesulfonic acid (PIPES), 2-(N-morpholino)ethanesulfonic acid (MES), and 3-morpholinopropan Production of lentiviral stocks and titration Lentivirus was made by transfecting 3 μg of pLenti4/V5‐hTERT expression plasmid and 12 μg of viral packaging vectors (Packaging Mix, Invitrogen) into 293FT cells (Invitrogen) by lipid transfection (Transfectin, Bio‐Rad, Hercules, CA, USA). Biogenova, Corp. The pLenti6V5-DEST Gateway Vector is a Gateway-adapted ViraPower lentiviral expression vector for lentiviral-based expression of a target gene in dividing and non-dividing mammalian cells. Small-molecule targeting of the cooperative folding process in the hTERT G-quadruplex promoter element produces telomerase-independent events, which impair mitochondrial processes resulting in apoptotic cell death and inhibition of prostate cancer cell growth. ΔU3. 1A ). 5. . Abstract. a HBET1, an hTERT-immortalized normal human bronchial epithelial cell line, was transduced with the EML4-ALK lentiviral vector or the control vector as in Fig. Thaw the lentivirus on ice. Thus, lentiviral vectors are gaining popularity for both in vitro and in vivo applications of gene transduction. Here, we report a real‐time and noninvasive method to monitor tumor response to a lentivirus‐based hTERT‐conditional suicidal gene therapy. Add 35 µl of lentiviral particles and mix the solution by flicking the tube. A single lv-hTERT vector immunization induces potent and broad HLA-B7-restricted CTL responses against hTERT. Sign Up Now The aim of the study was to analyze the effect of hTERT gene knockdown in HNSCC cells by using novel in vitro models of head and neck cancer (HNSCC), as well as improving its personalized therapy. Gene Synthesis sgRNA Synthesis qPCR Primers/Probes Exosome RNA NGS gRNA Cloning shRNA Cloning Lentiviral Packaging Recombinant Lentivirus (Lenti - hTERT-Neo Injection of lentiviral vectors encoding anti-hTERT siRNA significantly inhibited the growth of preestablished macroscopic xenograft tumors, which was in contrast to the finding that no obvious effects on cell growth, cell cycle progression and telomere length were observed in anti-hTERT siRNA expressing U87MG cells during short-term in vitro In our experiment, lentiviral vector would be employed to transfer hTERT gene into hMSCs, and the resulting expression of hTERT and senescencebypassing function - of hTERT transduction would also be explored. ; et al. hTERT-Immortalized Bone Mesenchymal Stromal Cells Expressing Rat Galanin via a Single Tetracycline-Inducible Lentivirus System By Ke An, Hui-ping Liu, Xiao-long Zhong, David Y. We focused on the hTERT, a potential target gene of miR-138 . hTERT-HM cells were first infected with Tet-On 3G lentiviral particles to produce sublines that constitutively expresses the reverse tetracycline receptor complex. 4 × 10 6 293FT cells were seeded into 10-cm tissue culture plates 8 hrs prior to transfection and the medium was replaced 16 hrs after the transfection. com when a pancreas-duodenal homeobox (Pdx)-1 transgene was expressed in hTERT-modified cells with a lentiviral vector, along with inductive signaling through activin A and serum deprivation. n. METHODS: Lentiviral vectors have been used for the stable integration and long-term expression of transgenes. Stop solution: 12 mL The biosafety issues associated with using recombinant lentiviral vectors, i. RPE1-hTERT Flag-Cas9 TP53 −/−, HeLa Flag-Cas9 and HCT116 Flag-Cas9-expressing cells were transduced with the lentiviral TKOv1 library at a low MOI (approx. hTERT promoter by analysis of the genome-wide chromatin immunoprecipitation (ChIP)-on-chip data,21 suggesting that YAP may participate in the regulation of hTERT expression. Anti‐human hTERT ELISA micro well strips: 96 wells, 12 strips 2. The final concentration of Polybrene is 8 µg/ml. Franchini Recombinant lentiviruses were prepared using the ViraPower Lentiviral Expression System (Life Technologies), according to the manufacturer's instructions. Detection antibody-biotin: 1 mL 6. Importantly, the immortalizing transgenes were under the control of the rat insulin 2 promoter. 0μl lenti-Pac HIV mix using Lipofectamine 3000 transfection reagent (Invitrogen). Furthermore, lentivirus-mediated overexpression of hTERT in fully senescent H-Ras G12V –expressing cells potentiated escape from OIS, demonstrating that hTERT expression and increased telomerase activity in senescent cells are a driver, and not a consequence, of senescence escape (Fig. To generate lentiviruses, each of the pLVSIN vectors (2 µg) was co-transfected with packaging vectors (lentiviral high titer packaging mix) (3. Moreover, transplantation studies in immunodeficient mice verified the capacity of these Versatile gene/shRNA expression system is a necessity in gene functional studies. com Lentivirus was made by transfecting 3 μg of pLenti4/V5-hTERT expression plasmid and 12 μg of viral packaging vectors (Packaging Mix, Invitrogen) into 293FT cells (Invitrogen) by lipid transfection (Transfectin, Bio-Rad, Hercules, CA, USA). The present invention also includes a vector and a cell containing the polynucleotide. Try jetOPTIMUS today! Magnetofection™ is a simple and highly efficient transfection method to transfect primary cells and hard to transfect cells. , 2008). Medium was collected after 48 and 72 hours, combined and filtered through a 0. Methods: A fusion reporter construct, containing humanized Renilla Although the ahMNCs were immortalized by lentiviral hTERT gene delivery (hTERT-682TL and hTERT-779TL), they did not form any detectable masses, even in the most sensitive neonate NOG mouse platform. Inspired by the validated and recognized magnetic drug targeting technology, this original method is a revolution for transfection and infection. 6 A , two shRNAs against Sp1, shSp1a and shSp1b, reduced its protein level by 90 and 70%, respectively, and two shRNAs, shSp3a and shSp3b, inhibited Sp3 Immortalized Cell Lines Immortalized cell lines are derived from primary cells that bypass normal cellular senescence and have an extended life span. LVs efficiently transduce slowly dividing cells, including hematopoietic stem-progenitor cells (HSCs), resulting in stable gene transfer and expression. In human cancer cells that exhibit constitutive hTERT activity, hPOT1 exerts control over telomere length. transcriptase (hTERT) and B lymphoma Mo-MLV insertion region 1 (Bmi-1). Skip to content For product queries: Call 1-858-678-8683 or email at info@gentarget. The system was tested in bladder cancer cells (T24 and 5637) and the results showed that the enhanced hTERT promoter could drive the expression of GAL4-P65 in these bladder cancer cell lines. Human fetal pancreases were transduced with lentiviral vectors expressing the large T antigen of simian virus 40 (SV40 LT) and human telomerase reverse transcriptase (hTERT) and were transplanted into SCID mice to allow pancreatic differentiation . 8 Compared to TRIPZ-Control cells, lentiviral 184-hTERT TRIPZ-shALDH1A3 pools show Phone: 858-247-5365 Fax: 858-345-3871 Email: info@biosettia. ΔU3. Annelise Bennaceur-Griscelli (Institut Gustave Roussy, Villejuif, France). Regulating transcription is the central basis of non‐canonical functions of telomerase. 3–1. We attempted to extend the lifespan of CD34+ stem/progenitor cells in human cord blood (CB) by transduction with lentiviral vectors carrying the human telomerase catalytic subunit (hTERT) and/or the human papillomavirus type 16 (HPV16) E6 and E7 oncogenes. BR. 151, Yanjiang Rd, Guangzhou 510120, People's Republic of China. Over the last decade, many studies have demonstrated that adoptive cancer antigen-specific T cell therapy is an effective option for leukemia therapy. S4C). Serial passaging and transduction with recombinant lentiviruses carrying hTERT gene Storage Directly and immediately transfer cells from dry ice to liquid nitrogen upon receiving and keep the cells in liquid nitrogen until cell culture needed for experiments. Background Radiotherapy is regarded as a milestone for the cure of cervical cancer. Haibo Tang Department of Cardiothoracic Surgery, The First Affiliated Hospital of Guangzhou Medical College, No. In the present study, we successfully developed a lentivirus-mediated transgene expression system of Dm-dNK under the control of hTERT promoter against the breast cancer cell line (Bcap37), the gastric cancer cell line (SGC7901) and the normal fibroblast cell line (WI-38). , (2007) SCp2 Yohei Hirai et al. htert lentivirus